View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7328_high_1 (Length: 555)
Name: NF7328_high_1
Description: NF7328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7328_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 330; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 144 - 539
Target Start/End: Complemental strand, 21244458 - 21244076
Alignment:
| Q |
144 |
ttgatgggtgaagtaagtctccgacggtctcttcggagttgaagattctgatagagccggtggtggtcctcttctatccttactcggcttcttgccactg |
243 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21244458 |
ttgatgggtgaagtaagtctccgatggtctcttcggagttgaagattctgatagagccggtggtggtcctcttctatccttactcggcttcttgccactg |
21244359 |
T |
|
| Q |
244 |
ctttccctaacaacgctctttagtggtgttatgga-aatgctctttatcctgttttgtttcttgattacttgaaacattcttttacctctgctcctttac |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21244358 |
ctttccctaacaacgctctttagtggtgttatggacaatgctctttatcctgttttgtttcttgattacttgaaacattcttttacctctgctc------ |
21244265 |
T |
|
| Q |
343 |
ctctgctcttttagggatcacattttcgcttacttacttgaattatatacgtgttcacattgttggtttctctgctgttcttttagccactttttccctt |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21244264 |
--------ttttagggatcacattttcgcttacttacttgaattatatacgtcttcatattgttggtttctctgctgttcttttagccactttttccctt |
21244173 |
T |
|
| Q |
443 |
tcaccgtttcttgttatcgcgattcttctttccgaaaatcagaccaagacgatggtttgttgtggattttaagaaggtgaattggcgtggttacttt |
539 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21244172 |
tcaccgtttcttgttatcgcgattcttctttccgaaaatcagaccaagacgatggtttgttgtggattttaagaaggtgaattggcgtggttacttt |
21244076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 9 - 67
Target Start/End: Complemental strand, 21244514 - 21244456
Alignment:
| Q |
9 |
tcgtgttagtgacattcccaccttattagcatcttgctgttaaggaagtggtttgcttg |
67 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21244514 |
tcgtgttagtgacattcccactttattagcatcttgctgttaaggaagtggtttgcttg |
21244456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 80; Significance: 3e-37; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 345 - 538
Target Start/End: Complemental strand, 255013 - 254818
Alignment:
| Q |
345 |
ctgctcttttagggatcacattttcgcttacttacttgaattatatacgtgttcacattgttggtttctctgctgttcttttagccactttttccctttc |
444 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||| |||||||| | | || |||||||||||||||||||||||||| ||||| ||| |||||| |||| |
|
|
| T |
255013 |
ctgctctcttagggatcactttttctcttacttatttgaattacagaggtcttcacattgttggtttctctgctgttgttttaaccattttttcactttt |
254914 |
T |
|
| Q |
445 |
accgtttcttgttatcgcgattc-ttct-ttccgaaaatcagaccaagacgatggtttgttgtggattttaagaaggtgaattggcgtggttactt |
538 |
Q |
| |
|
||| ||||||| |||| ||| |||| |||| |||||||||| ||| |||||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
254913 |
accctttcttgctatctttgttctttctgttcccaaaatcagactaagccgatggtttgttgtcgattttaataaggtcaattggcgtggttactt |
254818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 326
Target Start/End: Complemental strand, 255107 - 255045
Alignment:
| Q |
265 |
agtggtgttatgga-aatgctctttatcctgttttgtttcttgattacttgaaacattctttt |
326 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
255107 |
agtggtgttatggacaatgctctttatcctgttttgtttcttgattacttgaaacattctttt |
255045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 236
Target Start/End: Complemental strand, 255334 - 255256
Alignment:
| Q |
158 |
aagtctccgacggtctcttcggagttgaagattctgatagagccggtggtggtcctcttctatccttactcggcttctt |
236 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||||| ||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
255334 |
aagtctccggcggtccattcggagttgaggattctgttagtaccggcggtggtcctcttctatccttactcggtttctt |
255256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University