View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7328_high_2 (Length: 368)
Name: NF7328_high_2
Description: NF7328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7328_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 149 - 352
Target Start/End: Complemental strand, 45544504 - 45544303
Alignment:
| Q |
149 |
ttacgagtatctgttgccggaacttttgagatcgagaacttgaacaacgatgtcagggagatctgatgaagaatcaggagatggatttgagagcaaggtg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45544504 |
ttacgagtatctgttgccggaacttttgagatcaagaacttgaacaacgatgtcagggagatctgatgaagaatcaggagatggatttgagagcagggtg |
45544405 |
T |
|
| Q |
249 |
gagatggcgtttggggaaacggatttcgccatttggagattgtgaagtgagagaaattagggttcgagagggaaaatgaaaattaggttgaagagaaaga |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45544404 |
gagatggcgtttggggaaacggatttcgccatttggagattgtgaagt--gagaaattagggttcgagagggaaagtgaaaattaggttgaagagaaaga |
45544307 |
T |
|
| Q |
349 |
ggcg |
352 |
Q |
| |
|
|||| |
|
|
| T |
45544306 |
ggcg |
45544303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 45544618 - 45544585
Alignment:
| Q |
18 |
ttttccatcactggcagaaaacctaatccaagat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45544618 |
ttttccatcactggcagaaaacctaatccaagat |
45544585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 262
Target Start/End: Complemental strand, 24000925 - 24000848
Alignment:
| Q |
185 |
aacttgaacaacgatgtcagggagatctgatgaagaatcaggagatggatttgagagcaaggtggagatggcgtttgg |
262 |
Q |
| |
|
|||||||||||| | ||||| ||| |||||||||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24000925 |
aacttgaacaacaaattcaggaagaattgatgaagaatcagtcgatggatttgtaagcaatgtggagatggcgtttgg |
24000848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University