View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7328_low_2 (Length: 392)
Name: NF7328_low_2
Description: NF7328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7328_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 200 - 373
Target Start/End: Complemental strand, 13885637 - 13885464
Alignment:
| Q |
200 |
gctcgttcactgattcgttacttcaacaccactgagcagaacgccaatgctgatgatcctcttcgccctttccgtgcgacggatgttttctatccaggaa |
299 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13885637 |
gctcgtccactgattcgttacttcaacaccactgagcagaacgccaatgctgatgatcctcttcgccctttccgtgcgacagatgttttctatccaggaa |
13885538 |
T |
|
| Q |
300 |
gaatgttgagtcggttcatgttttcgttgatcgatcgtcacgtcaacgtgagagagacagaggagtctattgtt |
373 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13885537 |
gaatgttgagtcggttcatgttttcgatgatcgatcgtcacgtcaacgtgagagagacagaggagtctattgtt |
13885464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 51 - 200
Target Start/End: Complemental strand, 10117551 - 10117399
Alignment:
| Q |
51 |
aaaagaatgtctgagcccgaaatttctaagtcggcagcggataggatcagcagtttacccgac---atactgattcacatcctctcttgcgatggttcta |
147 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10117551 |
aaaagaatgtctgagcccgaaatttcgacatcggcagcggataggatcagcagtttacccgacgatatactgattcacatcctctcttgcgatggttcta |
10117452 |
T |
|
| Q |
148 |
gaaaaatgtccaatccttgaagatcttcaactatctgatatacacaggttctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10117451 |
gaaaaatgtccaatccttgaagatcttcaactatctgatatacacagtttctg |
10117399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University