View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7328_low_6 (Length: 291)
Name: NF7328_low_6
Description: NF7328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7328_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 45515379 - 45515649
Alignment:
| Q |
18 |
ctgttgtcgtcttcgtccttcacttacatctgcccttttcagacaacgcaccttcttcttcttcatcatcacattccgattattgcgatatggccaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515379 |
ctgttgtcgtcttcgtccttcacttacatctgcccttttcagacaacgcaccttcttcttcttcatcatcacattccgattattgcgatatggccaaact |
45515478 |
T |
 |
| Q |
118 |
agttcctttattatcatatgtatggacaattaaattgaattgaatgaggacacaaaatgaaggatttcaagttctc----------ttgaattgagttaa |
207 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45515479 |
agttcctttaatatcatatgtatggacaattaaattgaattgaatgaggacacaaaatgaaggatttcaagttctcttgaattgaattgaattgagttaa |
45515578 |
T |
 |
| Q |
208 |
atatagagagatataaagcttaccgttgttgttgttgctgttaccgggtaagtagagttgttgtggcacag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45515579 |
atatagagagatataaagcttaccgttgttgttgttgctgttactgggtaagtagagttgttgtggcacag |
45515649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University