View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7330_high_12 (Length: 361)
Name: NF7330_high_12
Description: NF7330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7330_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 57 - 349
Target Start/End: Complemental strand, 49099241 - 49098949
Alignment:
| Q |
57 |
taacgatgctcttgaattttgcacacaactaacaggttcaattgttgttccattggctttgaggtctgctattgatcttgggatctttgacatcctatcc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49099241 |
taacgatgctcttgaattttgcacacaactaacaggttcaattgttgttccattggctttgaggtctgctattgatcttgggatctttgacatcctatcc |
49099142 |
T |
 |
| Q |
157 |
aaagctggtaatagtgcacaactctctgcagatgatattgctgttaagattggaaccaaaaacccagaagcagcaacaatgttagatcgtcttcttaggt |
256 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49099141 |
aaagctggtaatggtgcacaactctctgcagatgatattgctgttaagattggaaccaaaaacccagaagcagcaacaatgttagatcgtcttcttaggt |
49099042 |
T |
 |
| Q |
257 |
tgttggcaagtcactctattctaaactcctatgttcctcaacatcctcaaacccttgagagattctacagcctctcaaaccactccaaatatt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49099041 |
tgttggcaagtcactctattctaaactcctatgttcctcaacatcctcaaacccttgagagattctacagcctctcaaaccactccaaatatt |
49098949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University