View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7330_high_24 (Length: 227)
Name: NF7330_high_24
Description: NF7330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7330_high_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 10307119 - 10306905
Alignment:
| Q |
13 |
gaacctgtgatacctccattacacgataatcgaatgatcctccaatggaatatgatgacaatgcgtctccgccgacagcttctggataagtcacatttcc |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10307119 |
gaacctgcgatacctccattacacgataatcgaatgatcctccaatggaatatgatgacaatgcgtctccgccgacagcttctggataagtcacatttcc |
10307020 |
T |
 |
| Q |
113 |
aatttcaactcggaaactgtcggaaggtgatcggagaatcgccgcgaggtcggattctgaagcgaaaatggtggaacggcaaagcggacaacatgagagg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10307019 |
aatttcaactcggaaactgtcggaaggtgatcggagaatcgccgcgaggtcggattctgaagcgaaaattgtggaacggcaaagcggacaacatgagagg |
10306920 |
T |
 |
| Q |
213 |
ttggaagaacggagc |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10306919 |
ttggaagaacggagc |
10306905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 103 - 216
Target Start/End: Complemental strand, 1722195 - 1722082
Alignment:
| Q |
103 |
tcacatttccaatttcaactcggaaactgtcggaaggtgatcggagaatcgccgcgaggtcggattctgaagcgaaaatggtggaacggcaaagcggaca |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
1722195 |
tcacatttccaatttcatctcggaaactgtcggaaggtgatcggagaatcgcggcgaggtcgaattctgaagcgaaaatggtggaatggcagagccgaca |
1722096 |
T |
 |
| Q |
203 |
acatgagaggttgg |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1722095 |
acatgagaggttgg |
1722082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University