View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7330_high_29 (Length: 201)
Name: NF7330_high_29
Description: NF7330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7330_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 51010105 - 51010272
Alignment:
| Q |
15 |
aatataacaggttggtgaagatcaaaatgtaatagattttatcacatctcaatgcattgtcatggtggatcaagaggggatgaaccactcaattggcttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010105 |
aatataacaggttggtgaagatcaaaatgtaatagattttatcacatctcaatgcattgtcatggtggatcaagaggggatgaaccactcaattggcttc |
51010204 |
T |
|
| Q |
115 |
aattcaatgagcaacatgcaatcaaatgtaggagatgaaaatgataacacaaacaatattttccatcc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010205 |
aattcaatgagcaacatgcaatcaaatgtaggagatgaaaatgataacacaaacaatattttccatcc |
51010272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University