View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7330_low_14 (Length: 345)
Name: NF7330_low_14
Description: NF7330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7330_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 24 - 331
Target Start/End: Original strand, 10306627 - 10306934
Alignment:
| Q |
24 |
gagtcgcctccagcttcactaaacatcgactcactccctccgattcctttccatttcacctccgattcaacaccaccgccgtcgcaaccacctccaccgg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||| | |
|
|
| T |
10306627 |
gagtcgcctccagcttcactaaacatcgactcactccctccgattccgttccatttcacctccgattcaacaccaccgtcgtcgcaaccacctcaacctg |
10306726 |
T |
 |
| Q |
124 |
cgcgggaaatacaacgagcaatcgattcacttcctacgtttcatttctcctccatttccaccaccgctaccgccaccgccaactgtgcagtttgccttac |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
10306727 |
cgccggaaatacaacgagcaatcgattcacttcctacgtttcatttctcctccatttccacgaccgctaccgccactgccgactgtgcagtttgccttac |
10306826 |
T |
 |
| Q |
224 |
cgcgttcagcaccactgacctcctccgcgctctccctaggtgttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306827 |
cgcgttcagcaccactgacctcctccgcgctctccctaggtgttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctca |
10306926 |
T |
 |
| Q |
324 |
tgatgtcc |
331 |
Q |
| |
|
|| ||||| |
|
|
| T |
10306927 |
tgttgtcc |
10306934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University