View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7330_low_25 (Length: 241)
Name: NF7330_low_25
Description: NF7330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7330_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 225
Target Start/End: Complemental strand, 696597 - 696381
Alignment:
| Q |
9 |
caacaatatgcacaaatctattacttaactagcttgaccatattcgagctacctacaaactcaaatatgaattattcaatatcctttaaattgctcacat |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
696597 |
caacaataagcacaaatctattacttaactagcttgaccatgttcgagctacctacaaactcaaagatggattgttcaatatccttcaaattgctcacat |
696498 |
T |
|
| Q |
109 |
tttaaaaagaatgtttattgaaagttacgaaacgattgattgaataatttaaagttaattgaacaatcatcaaactcaaataccatgattgattagcgat |
208 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
696497 |
tttaaaaagaatgtttattgaaagatacgaaacgattgattgaataatttaaaattaattgaacaatcatcaaactcaaataccatgattgattagcgat |
696398 |
T |
|
| Q |
209 |
aatatttaggtgatttc |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
696397 |
aatatttaggtgatttc |
696381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University