View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7331_high_10 (Length: 264)
Name: NF7331_high_10
Description: NF7331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7331_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 42013341 - 42013105
Alignment:
| Q |
10 |
aagaatatagggattggtgcggtatgtatgcttgggacataagaatgtgctctttgaaagtcttaggttcgattgcttgagttgggaagctagccattca |
109 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
42013341 |
aagaatataggaattggtgcggtatgtatgcttgggacataagaatgtgctctttgaaagtcttaggttcgattgcttgaactgagaagctagccattca |
42013242 |
T |
 |
| Q |
110 |
taagttggattagtgatttggtctagcatcaactgccctcttgattgagtcggatattgagtttagaaattttgttaaaaaattaaaatatcaaacggat |
209 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42013241 |
tacattggattagggatttggtctagcatcaactgccctcttgattgagtcggatattaagtttagaaattttgttaaaaaattaaaatatcaaacggat |
42013142 |
T |
 |
| Q |
210 |
tgatcaaatcaacaagttctttattgattgtttgttt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42013141 |
tgatcaaatcaacaagttctttattgattgtttgttt |
42013105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University