View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7331_low_15 (Length: 240)
Name: NF7331_low_15
Description: NF7331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7331_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 40 - 224
Target Start/End: Complemental strand, 14929795 - 14929611
Alignment:
| Q |
40 |
atatctttaaacatgagccacatttgaatattaactaaccatttgtctgttcaagccatcaaacacaagggggtcctgaatttcattgtggaaaactaga |
139 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14929795 |
atatctttaaacatgaaccacatttaaatattaactaaccatttgtctgttcaagccatcaaacacaagggggtcctgaatttcattgtggaagactaga |
14929696 |
T |
 |
| Q |
140 |
accttcaaaacctcaacaatttctgttggagtttgaagaaccctcttacgcctccagtaatcttccagctcacctgcaatataca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
14929695 |
accttcaaaacctcaacaatttctgttggagtttgaagaaccctcttacgtctccagtaatcttctagctcacctgcaatttaca |
14929611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University