View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7332_high_34 (Length: 310)

Name: NF7332_high_34
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7332_high_34
NF7332_high_34
[»] chr7 (1 HSPs)
chr7 (19-302)||(3625049-3625332)
[»] chr1 (2 HSPs)
chr1 (63-114)||(34049196-34049247)
chr1 (66-114)||(8934033-8934081)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 302
Target Start/End: Complemental strand, 3625332 - 3625049
Alignment:
19 gttcatacatggtttaaaacatgtccctcaaataataaatcggtgtctcacatttgctaaatcaaaatattgtttgttgattgcacatcggcaaaaatgc 118  Q
    |||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||| ||| ||||| |||    
3625332 gttcatacatggtttaaaacatgtcccttaaataataaatcgatgtctcgcatttgctaaatcaaaatatcgtttgttgattgcacgtcgacaaaagtgc 3625233  T
119 agattcgttgattgaaatcctgtttacttagcaaatcgagattttgtcactcagagagaatagtcagctggtcttcgacgcaatcactaaatcaatttaa 218  Q
    | ||||||||||||||||| |||||||||||||||||||||||||||||||||||  ||| |||||||||||||||||| ||||||||||||||| ||||    
3625232 aaattcgttgattgaaatcttgtttacttagcaaatcgagattttgtcactcagaaggaacagtcagctggtcttcgactcaatcactaaatcaacttaa 3625133  T
219 ttcattgggtgaagtgtttcttatccaacaaagttgctatagc-ttttctccctataactctcttagattgctcgccttcatctc 302  Q
    ||| || ||||||||||||||| |||||| ||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||    
3625132 ttcgtt-ggtgaagtgtttcttgtccaacgaagttgctatagctttttctccctttaactctcttagatttctcgccttcatctc 3625049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 63 - 114
Target Start/End: Complemental strand, 34049247 - 34049196
Alignment:
63 gtctcacatttgctaaatcaaaatattgtttgttgattgcacatcggcaaaa 114  Q
    |||||||| |||||||||||||||||||||||  |||||||| ||| |||||    
34049247 gtctcacacttgctaaatcaaaatattgtttgcagattgcacgtcgacaaaa 34049196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 114
Target Start/End: Complemental strand, 8934081 - 8934033
Alignment:
66 tcacatttgctaaatcaaaatattgtttgttgattgcacatcggcaaaa 114  Q
    ||||| ||||||||||||||||| |||| | |||||||||||| |||||    
8934081 tcacacttgctaaatcaaaatatcgtttttggattgcacatcgacaaaa 8934033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University