View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_high_37 (Length: 280)
Name: NF7332_high_37
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 12508886 - 12508631
Alignment:
| Q |
1 |
cttgttgtgtaattgaaaatctagaaatgtttggtgtgttggtaaggcttcactttagtatttatttgcgacaactaagattaagaaacttgacatcctt |
100 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508886 |
cttgtggtggaattgaaaatctagaaatgtttggtgtgttggtaaggcttcacattagtatttatttgcgacaactaagattaagaaacttgacatcctt |
12508787 |
T |
|
| Q |
101 |
tgaccatagactgtattgttttaaatgttgatgatgggagttttgtttttggagtcgggtaggagtggttttgtggtttatccagaaatggtgatggcac |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12508786 |
tgacc--agactgtattgttttaaatgttgatgatgggagttttg-ttttgaagtcg---------ggttttgtggtttatccagaaatggtgatggcac |
12508699 |
T |
|
| Q |
201 |
atggattagtggttttagtggcaaccagaagaagtctataatagtattcatgtggaaattatgtccat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508698 |
atggattagtggttttagtggcaaccagatgaagtctataatagtattcatgtggaaattatgtccat |
12508631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University