View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_high_46 (Length: 255)
Name: NF7332_high_46
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 11073547 - 11073765
Alignment:
| Q |
1 |
ttaaatttgttgaaagttggtgttatagaaagttggtggtggaggaggagtctggtggggaaaggattagattgtaggaggaaattttttaagcggtagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
11073547 |
ttaaatttgttgaaagttggtgttatagaaagttggtggtggaggaggagtctggtggggaaaggataagattgtaggaggaaatcttttaagcggtagt |
11073646 |
T |
 |
| Q |
101 |
tactctttaagacagactaaccataggaggtacctcacttcatgcaatgataaactagattacaattcactttgatgaatatcaatgttgtagagaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11073647 |
tactctttaagacagactaaccataggaggtacctcacttcatgcaatgataaactagattacaattcacttcgatgaatatcaatgttgtagagaaaga |
11073746 |
T |
 |
| Q |
201 |
acaatgcaatataaactcc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11073747 |
acaatgcaatataaactcc |
11073765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University