View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_23 (Length: 407)
Name: NF7332_low_23
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 2 - 393
Target Start/End: Complemental strand, 40405053 - 40404664
Alignment:
| Q |
2 |
ctaatatcaattgtagtgaataaaataatggtcggtattatatgcatgtataacaaatcatttttctatataagatatcaaccttgattttctaactgta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40405053 |
ctaatatcaattgtagtgaataaaataatggtcggtattatatgcatgtataacaaatcatttttctgtataagatatcaaccttgattttctaactgta |
40404954 |
T |
|
| Q |
102 |
ctagtactattcattttgttagatctaaatactaattttcttcttctttttcagtagtatattgtaatttaagtatttaacttcttttgattgccagttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404953 |
ctagtactattcattttgttagatctaaatactaattttcttcttctttttcagtagtatattgtaatttaagtatttaacttcttttgattgccagttg |
40404854 |
T |
|
| Q |
202 |
tgtgagaatcgatgcggaatatgcacttgagcacattttgtctcccaacaaaaatacaaaaatcaccaagttaacttgcaatttgtctcccaattctcaa |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404853 |
tgtgagaatcgatgcggaatatgcacttgagcacattttgtctcccaacaaaaatac-aaaatcaccaagttaacttgcaatttgtctcccaattctcaa |
40404755 |
T |
|
| Q |
302 |
tgcattttcttactcaattctattcttaaagtacacaacaattcgattggttattgctttatgtatatgaaatttggatcttacccttttgg |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40404754 |
tgcattttcttactcaattctattcttaaagtacacaacaattcgtttggttattgctttatg-atatgaaatttggatcttacccttttgg |
40404664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University