View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_30 (Length: 339)
Name: NF7332_low_30
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 310
Target Start/End: Original strand, 2179021 - 2179312
Alignment:
| Q |
17 |
attgagcagcccccaaagtcaagcacctccttttactttcctttatcaaatgtcaccgattcaataattgatacatctgtcttgatagcacacataatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2179021 |
attgagcagcccccaaagtcaagcacctccttttactttcctttatcaaatgtcaccgattcaataattgatacatctgtcttgatagcaca--taatgg |
2179118 |
T |
 |
| Q |
117 |
tgatgagcagcaccctttcattttagaacttgtagatcaacaaactaatgtcttatgaaagtcaaacgtcgcgatggttaggtcacctggtacaaccacc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2179119 |
tgatgagcagcaccctttcattttagaacttgtagatcaacaaactaatgtcttatgaaagtcaaacgttgcgatggttaggtcacctggtacaaccact |
2179218 |
T |
 |
| Q |
217 |
ccttttgttgtggctactactctccacctttgtcgagatgccaacggcgttggaatttctcgttctctctttgcttttcaagttacttgcttat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2179219 |
ccttttgttgtggctactactctccacctttgtcgagatgccaacggcgttggaatttctcgttctctctttgcttttcaacttacttgcttat |
2179312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 168
Target Start/End: Original strand, 26993282 - 26993323
Alignment:
| Q |
127 |
caccctttcattttagaacttgtagatcaacaaactaatgtc |
168 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
26993282 |
caccctttcattttggaacctgtagatcaacagactaatgtc |
26993323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University