View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_40 (Length: 295)
Name: NF7332_low_40
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 22 - 279
Target Start/End: Complemental strand, 47422105 - 47421848
Alignment:
| Q |
22 |
aaaatgatgcattctcatgttcaaacttctccttacaattttgagcactcttcttgatcccaagctcagctagcttactgcacacaacgattgacataat |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47422105 |
aaaatgatgcgttctcatgttcaaacttctccttacaattttgagcactcttcttgatcccaagctcagctagcttactgcacacaacaattgacataat |
47422006 |
T |
 |
| Q |
122 |
taaccaaatatcaatgaaacatttatataataattgtaattaccttgagacatgatcccatgtgatgagttgatctgggaagaaattgtggatggtagat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47422005 |
taaccaaatatcaatgaaacatttatataataattgtaattaccttgagacatgatcccatgtgatgagttgatctgggaagaaattgtggatggtagat |
47421906 |
T |
 |
| Q |
222 |
gtgatcttgaagagtacaagaagttcgtggttggtccagctagaatcgatgatcaacg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421905 |
gtgatcttgaagagtacaagaagttcgtggttggtccagctagaatcgatgatcaacg |
47421848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University