View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_47 (Length: 266)
Name: NF7332_low_47
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_47 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 342540 - 342793
Alignment:
| Q |
13 |
atcagaaagcaaaaaattgaaactacaacatttgcattagtgttttaacttgttggattggactattgatgttgtaaatgttatagaaacctaaaatcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
342540 |
atcagaaagcaaaaaattgaaactacaacatttgcattagtgttttaacttgttggattggactattgatgttgtaaatgttatagaaagctaaaatcaa |
342639 |
T |
 |
| Q |
113 |
ggaaatgtcaaataggaaggataccgttgagagcttattgagagtgccgtcaatctgaacaaagtaagcttccaagagcatctcaagctcctcaacatca |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342640 |
ggaaatgtaaaataggaaggataccgttgagagcttattgagagtgccgtcaatctgaacaaagtaagcttccaagagcatctcaagctcctcaacatca |
342739 |
T |
 |
| Q |
213 |
agcttagtggtggtgacactgtaagtagttcttgcacgtgttccgcggctatcc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
342740 |
agcttagtggtggtgacactgtaagtagtacttgcacgtgttccgcggctatcc |
342793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University