View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_50 (Length: 257)
Name: NF7332_low_50
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 32 - 240
Target Start/End: Original strand, 49699516 - 49699724
Alignment:
| Q |
32 |
gttaacatggtaataactcctcttcatctatatctcaatgttcagattagaaaaggatagacattataactacttctggttgcggtgttcaaagtttatt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49699516 |
gttaacatggtaataactcctcttcatctatatctcaatgttcagattagaaaaggatagacattataactacttctggttgcggtgttcaaagtttatt |
49699615 |
T |
 |
| Q |
132 |
tgtgtgagtatttactattacaacagttactagttaattgcatacttaatttcctcgtggagctgaataagtttataacaagcattgtcttgtgtttaca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49699616 |
tgtgtgagtatttactattacaacagttactagttaattgcatacttaatttcctcgtggagctgaatgagtttataacaagcattgtcttgtgtttaca |
49699715 |
T |
 |
| Q |
232 |
ctgtaggtt |
240 |
Q |
| |
|
||||||||| |
|
|
| T |
49699716 |
ctgtaggtt |
49699724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University