View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_55 (Length: 251)
Name: NF7332_low_55
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 601899 - 602100
Alignment:
| Q |
16 |
caattttgactctgtttcctcaaggggtggactaggatttctcccagatatagtgagttatcatgacaccaa-catagcccttattgacatgatgaatgt |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
601899 |
caattttgactctgtttcctcagggggtggactaggatttctcccagata--gtgagttatcatgacaccaaacatagcccttattgacatgatgaatgt |
601996 |
T |
 |
| Q |
115 |
atagccaatacatcaaagggaaagagaagaggattggatgatccacttttctttgatacactgtaataatataatgttgtacatttaaaacagattatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
601997 |
atagccaatacatcaaagggaaagagaagaggattggatgatccacttttctttgatacactgtaataatataatgttgtacatttaaaacagattatta |
602096 |
T |
 |
| Q |
215 |
aact |
218 |
Q |
| |
|
|||| |
|
|
| T |
602097 |
aact |
602100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University