View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_59 (Length: 249)
Name: NF7332_low_59
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 19505668 - 19505810
Alignment:
| Q |
1 |
aaaggcaatgggagaaatgctagtgggaactatgaaggaaaaattgtcaattgttattgtgagacctacaatcattaccagcacttacaaagaacctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19505668 |
aaaggcaatgggagaaatgctagtgggaactatgaaggaaaaattgtccattgttattgtgagacctacaatcattaccagcacttacaaagaacctttc |
19505767 |
T |
 |
| Q |
101 |
cctggttgggttgaaggagtaaggtaaattaatcaatcaccaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19505768 |
cctggttgggttgaaggagtaaggtaaattaatcaatcaccaa |
19505810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 129
Target Start/End: Complemental strand, 36183139 - 36183015
Alignment:
| Q |
5 |
gcaatgggagaaatgctagtgggaactatgaaggaaaaattgtcaattgttattgtgagacctacaatcattaccagcacttacaaagaacctttccctg |
104 |
Q |
| |
|
||||||||||||||||| || | |||| | |||||||| |||| |||||||||| | || || || |||| ||||||| | |||||||||||||| |
|
|
| T |
36183139 |
gcaatgggagaaatgcttgtagaaactttcaaggaaaacatgtctgttgttattgttcgtcccaccattgttactagcacttttagagaacctttccctg |
36183040 |
T |
 |
| Q |
105 |
gttgggttgaaggagtaaggtaaat |
129 |
Q |
| |
|
| ||||||||||| |||||||||| |
|
|
| T |
36183039 |
gatgggttgaaggcttaaggtaaat |
36183015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University