View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7332_low_70 (Length: 208)
Name: NF7332_low_70
Description: NF7332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7332_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 134
Target Start/End: Complemental strand, 27000859 - 27000748
Alignment:
| Q |
19 |
ccaatctcatgctaatcctagatcattggcctgttatttctcgtcactcaacagtcatgacaatttatttatttatttatctaggttgcatgttgcttct |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
27000859 |
ccaatctcatgttaatcctagatcattggcctgttatttgtcgtcactcaacagtcatgacaatttatttat----ttatccaggttgcatgttgcttct |
27000764 |
T |
|
| Q |
119 |
tgttaattgtctatat |
134 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27000763 |
tgttaattgtctatat |
27000748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 130 - 195
Target Start/End: Complemental strand, 27000924 - 27000859
Alignment:
| Q |
130 |
tatataagaaagatgacccatataactaattaatgccttaaaattttgggtggagatgtgatgtcc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27000924 |
tatataagaaagatgacccatataactaattaatgccttaaaattttgggtggagatgtggtgtcc |
27000859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 127
Target Start/End: Complemental strand, 26986638 - 26986581
Alignment:
| Q |
67 |
caacagtcatgacaatttatttatttatttatctaggttgcatgttgcttcttgttaattg |
127 |
Q |
| |
|
||||| ||||||||||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
26986638 |
caacattcatgacaattta---atttatttattcatgttgcatgttgcttcttgttaattg |
26986581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University