View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7333_low_23 (Length: 232)
Name: NF7333_low_23
Description: NF7333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7333_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 112 - 222
Target Start/End: Original strand, 25898161 - 25898271
Alignment:
| Q |
112 |
ttaatgattattgaattactgagctattcttctgaaggccggaatttgaaattcgttaatttattctacggtctacaaatattgtcttaacacaatattt |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25898161 |
ttaatgattattgaattattgagctattcttctgaaggccggaatttgaaattcgttaatttattctacggtctacaaatattgtcttaacacaatattt |
25898260 |
T |
|
| Q |
212 |
ttgaggttctt |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
25898261 |
ttgaggttctt |
25898271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University