View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7333_low_7 (Length: 438)
Name: NF7333_low_7
Description: NF7333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7333_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 128 - 423
Target Start/End: Complemental strand, 36804177 - 36803882
Alignment:
| Q |
128 |
atataatctaactttttaaacggagctttgatacttgaaagggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaacttcc |
227 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36804177 |
atataatttaactttttaaatagagctttgatacttgagagggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaacttcc |
36804078 |
T |
 |
| Q |
228 |
cttttagtgagatcgatgactccatgagggaggggaagtagtccgatgatgatttcattttaacagacgacaaatggtattaacttggacgggagattct |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36804077 |
cttttagtgagatcgatgactccatgagggaggggaagtagtccgatgatgatttcattttaacagacgacaaatggtattaacttggacgggagattct |
36803978 |
T |
 |
| Q |
328 |
tgtcatttgtataattaaattatggaggttagtgcttgattgaaatatagaaggagtgtttgtgttgtttgaagagaactcaagggaggtcattgt |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36803977 |
tgtcatttgtataattaaattatggaggttagtgcttgattggaatatagaaggagtgtttgtgttgtttgaagagaactcaagggaggtcattgt |
36803882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University