View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7334_low_1 (Length: 232)
Name: NF7334_low_1
Description: NF7334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7334_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 2172512 - 2172306
Alignment:
| Q |
15 |
agaaataatgggtctaattgagtggtttgaaaataatgatataaattcatcagcaatgatgaacggccatgatttggtttttactagcttagagaatgtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2172512 |
agaaataatgggtctaattgagtggtttgaaaataatgatataaattcatcagcaatgatgaacggccatgatttggtttttactagcttagagaatgtt |
2172413 |
T |
|
| Q |
115 |
gaaccttatttagctatgtttcaagacaagtttaaaccaattcatgtgtcttattacattgagccagtttttggagaaggacatgttttgattcttccaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2172412 |
gaaccttatttagctatgtttcaagacaagtttaaaccaattcatgtgtcttattacattgagccagtttttggagaaggacatgttttgattcttccaa |
2172313 |
T |
|
| Q |
215 |
caccaaa |
221 |
Q |
| |
|
|| |||| |
|
|
| T |
2172312 |
catcaaa |
2172306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University