View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7335_high_7 (Length: 253)
Name: NF7335_high_7
Description: NF7335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7335_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 101 - 246
Target Start/End: Complemental strand, 33422610 - 33422466
Alignment:
| Q |
101 |
ttggcttgatgatatgtcgctaatgggaaaaataactttacttccagctgaagccttctttgtctgccatctcacaggaatttttctatatctgtggtca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33422610 |
ttggcttgatgatatgtcgctaatgggaaaaataactttacttccagctgaagccttctttgtctgccatctcacaggaatttttctatatttgtggtca |
33422511 |
T |
 |
| Q |
201 |
atgtttgctttgggcacagcaacaataactgtatctttcttctcac |
246 |
Q |
| |
|
||| ||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
33422510 |
atg-ttgcttttggcacagcaccaataactgtatctttcttttcac |
33422466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 69
Target Start/End: Original strand, 16989885 - 16989933
Alignment:
| Q |
20 |
ttgttttgttgtaacagctagcctctttttgcacttctggtgcttggctt |
69 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
16989885 |
ttgtttggttgtaacagctagc-tcttttagcacttccggtgcttggctt |
16989933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University