View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7335_high_7 (Length: 253)

Name: NF7335_high_7
Description: NF7335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7335_high_7
NF7335_high_7
[»] chr2 (1 HSPs)
chr2 (101-246)||(33422466-33422610)
[»] chr4 (1 HSPs)
chr4 (20-69)||(16989885-16989933)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 101 - 246
Target Start/End: Complemental strand, 33422610 - 33422466
Alignment:
101 ttggcttgatgatatgtcgctaatgggaaaaataactttacttccagctgaagccttctttgtctgccatctcacaggaatttttctatatctgtggtca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33422610 ttggcttgatgatatgtcgctaatgggaaaaataactttacttccagctgaagccttctttgtctgccatctcacaggaatttttctatatttgtggtca 33422511  T
201 atgtttgctttgggcacagcaacaataactgtatctttcttctcac 246  Q
    ||| ||||||| ||||||||| ||||||||||||||||||| ||||    
33422510 atg-ttgcttttggcacagcaccaataactgtatctttcttttcac 33422466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 69
Target Start/End: Original strand, 16989885 - 16989933
Alignment:
20 ttgttttgttgtaacagctagcctctttttgcacttctggtgcttggctt 69  Q
    |||||| ||||||||||||||| |||||| ||||||| ||||||||||||    
16989885 ttgtttggttgtaacagctagc-tcttttagcacttccggtgcttggctt 16989933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University