View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7335_low_8 (Length: 256)
Name: NF7335_low_8
Description: NF7335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7335_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 67 - 239
Target Start/End: Complemental strand, 44681918 - 44681743
Alignment:
| Q |
67 |
ccaatatactattaaaccctaaatgtacatttgtgttgatggcgatcaagtttaaaagtattacaatatacttcgtcttgtacagagacttgattaataa |
166 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||||| | |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44681918 |
ccaatatacgattaaaccctaaatgcatgtttgtgttaacggcggtcaagtttaaaagtattacgatatacttcgtcttgtacagagacttgattaataa |
44681819 |
T |
|
| Q |
167 |
taaaattttgccgtttt---nnnnnnngtatcatggtatattaccgtgatttcatcaaactcactgtcattctaaa |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44681818 |
taaaattttgccgttttaaaaaaaaaagtatcatggtatattaacgtgatttcatcaaactcactgtcattctaaa |
44681743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University