View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7336_high_8 (Length: 290)
Name: NF7336_high_8
Description: NF7336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7336_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 42293679 - 42293398
Alignment:
| Q |
1 |
atctatgcataagaaattcttcatcattgacatttccataaagaaaatttataaacgtctgaaaagattggattgacatgtcggtgatgtttatcgtaga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42293679 |
atctatgcataagaaactcttcatcattaacatttccataaagaaaatttataaacgtctgaaaagattgaattgacatgtcggtgatgtttatcgtaga |
42293580 |
T |
|
| Q |
101 |
caaatcagtctccttaacattatgtgaaaacatgctgcgaaacacagatgattgtgaagacagaacagctcgatgagctcttatgcttccctcggaattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42293579 |
caaatcagtctccttaacattatgtgaaaacatgctgcgaaacacagatgattgtgaagacagaacagctcgatgagctcttatgtttccctcggaattg |
42293480 |
T |
|
| Q |
201 |
acattgattgttatgtctgtatagatatcttctcttatcattcgacctagggattcaagggccgctgcattttgtctctgct |
282 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293479 |
acgttgattgttatgtctgtatagatatcttctcttatcattcgacctagggattcaagggccgctgcattttgtctctgct |
42293398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University