View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_106 (Length: 212)
Name: NF7337_high_106
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_106 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 114
Target Start/End: Original strand, 32505634 - 32505732
Alignment:
| Q |
16 |
ctaacatcaaactctgttgtttcacctaaaacacgttcagctgttgataactctgcttccaccaccaacgatttttcttccaacgatgaccgaattgat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505634 |
ctaacatcaaactctgttgtttcacctaaaacacgttcagctgttgataactctgcttccaccaccaacgatttttcttccaacgatgaccgaattgat |
32505732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 196
Target Start/End: Original strand, 32505768 - 32505808
Alignment:
| Q |
156 |
taattcagacgattcaacatccgaaagcaccgccaacaaca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32505768 |
taattcagacgattcaacatccgaaagcaccaccaacaaca |
32505808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University