View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7337_high_106 (Length: 212)

Name: NF7337_high_106
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7337_high_106
NF7337_high_106
[»] chr8 (2 HSPs)
chr8 (16-114)||(32505634-32505732)
chr8 (156-196)||(32505768-32505808)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 114
Target Start/End: Original strand, 32505634 - 32505732
Alignment:
16 ctaacatcaaactctgttgtttcacctaaaacacgttcagctgttgataactctgcttccaccaccaacgatttttcttccaacgatgaccgaattgat 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32505634 ctaacatcaaactctgttgtttcacctaaaacacgttcagctgttgataactctgcttccaccaccaacgatttttcttccaacgatgaccgaattgat 32505732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 156 - 196
Target Start/End: Original strand, 32505768 - 32505808
Alignment:
156 taattcagacgattcaacatccgaaagcaccgccaacaaca 196  Q
    ||||||||||||||||||||||||||||||| |||||||||    
32505768 taattcagacgattcaacatccgaaagcaccaccaacaaca 32505808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University