View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_30 (Length: 477)
Name: NF7337_high_30
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 3e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 43438479 - 43438587
Alignment:
| Q |
1 |
tgctatacaagggtttcatttttgtggatgtgataggaagagagaaaaggaatggaaagatgtgtgaatgatgagtttatgtttttaggatatgaggtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43438479 |
tgctatacaagggtttcatttttgtggatgtgataggaagagagaaaaggaatggaaagatgggtgaatgatgagtttatgtttttaggatatgaggtat |
43438578 |
T |
|
| Q |
101 |
ggtgccatt |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
43438579 |
ggtgccatt |
43438587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 393 - 466
Target Start/End: Original strand, 2667870 - 2667943
Alignment:
| Q |
393 |
tgggttggcctgtcggtattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctct |
466 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||| || | |||||| | ||||| ||||||||||||||| |
|
|
| T |
2667870 |
tgggttggcctggtggtattggcttgggatctgggagtgtgctcttcctcgaggtctcaggttcgattatctct |
2667943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 181 - 251
Target Start/End: Original strand, 9658261 - 9658331
Alignment:
| Q |
181 |
tggattcataaaccgttaggacaaagagccatcttcaagggacctaaattccctgcataaattattgcgtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658261 |
tggattcataaaccgttaggacaaagagccatcttcaagggacctaaattccctgcataaattattgcgtg |
9658331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 408 - 465
Target Start/End: Complemental strand, 42644963 - 42644906
Alignment:
| Q |
408 |
gtattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctc |
465 |
Q |
| |
|
|||||| |||||||||| |||| |||| |||||||| ||||| |||||||||||||| |
|
|
| T |
42644963 |
gtattgacttgggatctgagagtgtgttcttcctcaaagtctcaggttcgattatctc |
42644906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 416 - 472
Target Start/End: Original strand, 12877724 - 12877780
Alignment:
| Q |
416 |
ttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctctgctact |
472 |
Q |
| |
|
||||||| | ||||| ||||| ||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
12877724 |
ttgggatttgggagtgtgtttctcctcaatgtctcaggttcgattctctctggtact |
12877780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 407 - 467
Target Start/End: Original strand, 6650617 - 6650677
Alignment:
| Q |
407 |
ggtattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctctg |
467 |
Q |
| |
|
||||||| ||||||||| |||||||| | ||||||||||||| ||||||||| |||||| |
|
|
| T |
6650617 |
ggtattggcttgggatcggggagtatgctcctcctcaatgtctcaggttcgattctctctg |
6650677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 409 - 465
Target Start/End: Original strand, 9964462 - 9964518
Alignment:
| Q |
409 |
tattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctc |
465 |
Q |
| |
|
||||| |||||||||| ||||| || | |||||||||||||| |||| ||||||||| |
|
|
| T |
9964462 |
tattgacttgggatctgggagtgtgctcttcctcaatgtctcaggtttgattatctc |
9964518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University