View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_64 (Length: 290)
Name: NF7337_high_64
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 114 - 275
Target Start/End: Complemental strand, 43015776 - 43015615
Alignment:
| Q |
114 |
agtgggtttaatgaaccatgatttatatgaaaaacttgcacatattccggacacaaaagtaagacattgatgcaagccgtaatttgaaaaaatgaaagtg |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
43015776 |
agtgggtttaatgaacgatgatttatatgaaacacttgcacatattccggacacaaaagtaagacattgatgcaagccgtaatttgaaaaaataaaaatg |
43015677 |
T |
 |
| Q |
214 |
gttgaatgtaactatatatgtcggtgtcagacatgaacatgtgtcaaacactagacatatct |
275 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015676 |
gttgattgtaactatatatgtcggtgtcagacatgaacatgtgtcaaacactagacatatct |
43015615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 43015836 - 43015792
Alignment:
| Q |
16 |
atgctatgctttattgaaatttaaattaccaataaaaattagagg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015836 |
atgctatgctttattgaaatttaaattaccaataaaaattagagg |
43015792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University