View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7337_high_64 (Length: 290)

Name: NF7337_high_64
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7337_high_64
NF7337_high_64
[»] chr8 (2 HSPs)
chr8 (114-275)||(43015615-43015776)
chr8 (16-60)||(43015792-43015836)


Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 114 - 275
Target Start/End: Complemental strand, 43015776 - 43015615
Alignment:
114 agtgggtttaatgaaccatgatttatatgaaaaacttgcacatattccggacacaaaagtaagacattgatgcaagccgtaatttgaaaaaatgaaagtg 213  Q
    |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||    
43015776 agtgggtttaatgaacgatgatttatatgaaacacttgcacatattccggacacaaaagtaagacattgatgcaagccgtaatttgaaaaaataaaaatg 43015677  T
214 gttgaatgtaactatatatgtcggtgtcagacatgaacatgtgtcaaacactagacatatct 275  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43015676 gttgattgtaactatatatgtcggtgtcagacatgaacatgtgtcaaacactagacatatct 43015615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 43015836 - 43015792
Alignment:
16 atgctatgctttattgaaatttaaattaccaataaaaattagagg 60  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
43015836 atgctatgctttattgaaatttaaattaccaataaaaattagagg 43015792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University