View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_70 (Length: 261)
Name: NF7337_high_70
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_70 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 44 - 261
Target Start/End: Complemental strand, 3909525 - 3909308
Alignment:
| Q |
44 |
tctacttagaccttttattcnnnnnnncgaaacaagatagattaatttctcagagctatgctttctatctttggattttctaggtgcagcaacaacatga |
143 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909525 |
tctacttagaccttttattcaaaaaaacgaaacaagatagattaatttctcagagctatgctttctatctttggattttctaggtgcagcaacaacatga |
3909426 |
T |
 |
| Q |
144 |
ataagatcactgaggaggattgaactctgacagatcatgccattgatttagagccaaagaagcagatccactagccccagcaccaacactaccattacca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909425 |
ataagatcactgaggaggattgaactctgacagatcatgccattgatttagagccaaagaagcagatccactagccccagcaccaacactaccattacca |
3909326 |
T |
 |
| Q |
244 |
ccagcaccagcaccagca |
261 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3909325 |
ccagcaccagcaccagca |
3909308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University