View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7337_high_74 (Length: 253)

Name: NF7337_high_74
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7337_high_74
NF7337_high_74
[»] chr3 (1 HSPs)
chr3 (10-118)||(29388130-29388238)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 10 - 118
Target Start/End: Original strand, 29388130 - 29388238
Alignment:
10 tcgaagaatattacgatgtccttaccaattaggttatagtcactgatagatatttaatggttttcacttgcactgatgttcgtccttgacacatgatttt 109  Q
    |||||| |||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||    
29388130 tcgaagcatattacgatgtccttaccaattaggttatagtcacggatagagattaaatggttttcacttgcactgatgttcgtccttgacacatgatttt 29388229  T
110 gttttaatg 118  Q
    |||||||||    
29388230 gttttaatg 29388238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University