View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_74 (Length: 253)
Name: NF7337_high_74
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 10 - 118
Target Start/End: Original strand, 29388130 - 29388238
Alignment:
| Q |
10 |
tcgaagaatattacgatgtccttaccaattaggttatagtcactgatagatatttaatggttttcacttgcactgatgttcgtccttgacacatgatttt |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29388130 |
tcgaagcatattacgatgtccttaccaattaggttatagtcacggatagagattaaatggttttcacttgcactgatgttcgtccttgacacatgatttt |
29388229 |
T |
 |
| Q |
110 |
gttttaatg |
118 |
Q |
| |
|
||||||||| |
|
|
| T |
29388230 |
gttttaatg |
29388238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University