View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_77 (Length: 250)
Name: NF7337_high_77
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_77 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 39063161 - 39062926
Alignment:
| Q |
14 |
atatcaaatgaaagaaaatcctctaatgatgtaggcatatcattggattagatgtctgctttaagaaaagggggattttcaaagttagtagtttataagg |
113 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39063161 |
atatcaaaggaaagaaaatcctctagtgatgtaggcatatcattggattagatgtctgctttaagaaaagggggattttcaaagttagtagtttacaagg |
39063062 |
T |
|
| Q |
114 |
atggtaacaataagatgattacaatagcatattgagttgat---gaggcaaacacaatgaactcgtggtagtggattctgaatttatcgcttaatgaact |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39063061 |
atggtaacaataagatgattacaatagcatattgagttgatgacgaggcaaacacaatgaactcgtggtagtggattctgaatttatcgcttaatgaact |
39062962 |
T |
|
| Q |
211 |
tcaaaatatttaaccaaaagtgtatggtttcatttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062961 |
tcaaaatatttaaccaaaagtgtatggtttcatttc |
39062926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University