View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7337_high_78 (Length: 249)

Name: NF7337_high_78
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7337_high_78
NF7337_high_78
[»] chr6 (1 HSPs)
chr6 (5-225)||(35211317-35211537)


Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 35211537 - 35211317
Alignment:
5 ccctgagaactaacccaggagtgctctgggctttatggttagcatatttatgtctaatagaacatacctatcttccctcggaaagatgacattgacaata 104  Q
    |||||| | |||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35211537 ccctgatagctaacccaagagtgctctgggctttatgtttatcatatttatgtctaatagaacatacctatcttccctcggaaagatgacattgacaata 35211438  T
105 gatgagcagaaatattcactctgaatattcagtattagtgcctcttagtttaatgtttctttatgcagctaggttttttagctcataaattataaacaaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35211437 gatgagcagaaatattcactctgaatattcagtattagtgcctcttagtttaatgtttctttatgcagctaggttttttagctcataaattataaacaaa 35211338  T
205 gctattaatttaccatttctg 225  Q
    |||||||||||||||||||||    
35211337 gctattaatttaccatttctg 35211317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University