View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_82 (Length: 247)
Name: NF7337_high_82
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_82 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 3781596 - 3781411
Alignment:
| Q |
1 |
tgtatatagatccacacgctcaatatatttgtgtttggtgtgcggatataaataaatgagtagtgcaaaatcagaaatctgaaaacaggtggcagaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3781596 |
tgtatatagatccacacgctcaatatatttgtgtttggtgtgtggatataaataaatgagtagtgcaaaatcagaaatctgaaaacagttggcagaatga |
3781497 |
T |
 |
| Q |
101 |
atcttaaacttcactctaataccatattttgaatgaatatcacaaaattaaaaagaatgatctttcatcgattaaatgtgagtgtt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3781496 |
atcttaaacttcactctaataccatattttgaatgaatatcacaaaattaaaaagaatgatctttcatcgattaaatgtgagtgtt |
3781411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University