View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_90 (Length: 240)
Name: NF7337_high_90
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 72 - 149
Target Start/End: Complemental strand, 19282690 - 19282613
Alignment:
| Q |
72 |
cggcaccaccattagcaccattgtcaaaatttcccatacctaaaggatgagccacatcaacatgatcagaaacagcaa |
149 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19282690 |
cggcaccaccactagcaccattgtcaaaatttcccatatctaaaggatgagccacatcagcatgatcagaaacagcaa |
19282613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Complemental strand, 19282552 - 19282522
Alignment:
| Q |
210 |
taagcaaatactcttgtggtgtaacttgata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19282552 |
taagcaaatactcttgtggtgtaacttgata |
19282522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University