View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7337_high_90 (Length: 240)

Name: NF7337_high_90
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7337_high_90
NF7337_high_90
[»] chr3 (2 HSPs)
chr3 (72-149)||(19282613-19282690)
chr3 (210-240)||(19282522-19282552)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 72 - 149
Target Start/End: Complemental strand, 19282690 - 19282613
Alignment:
72 cggcaccaccattagcaccattgtcaaaatttcccatacctaaaggatgagccacatcaacatgatcagaaacagcaa 149  Q
    ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||    
19282690 cggcaccaccactagcaccattgtcaaaatttcccatatctaaaggatgagccacatcagcatgatcagaaacagcaa 19282613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Complemental strand, 19282552 - 19282522
Alignment:
210 taagcaaatactcttgtggtgtaacttgata 240  Q
    |||||||||||||||||||||||||||||||    
19282552 taagcaaatactcttgtggtgtaacttgata 19282522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University