View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_high_92 (Length: 238)
Name: NF7337_high_92
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_high_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 29926126 - 29925907
Alignment:
| Q |
1 |
aaattttattattaagaagtctctatgctacttatgttggagatgctcttagtaaatgaatttctatttatacatgaaatcaaaaaagtaaaataaatgc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29926126 |
aaattttattattaagaaatctctatgctacttatgttggagatgctcttagtaaatgaatttctatttatacatgaaatcaaaaaagtaaaataaatgc |
29926027 |
T |
 |
| Q |
101 |
atttaactacattttgttaagttagaaatgtgttttctcatcaacttataataaatttctatttataccgtcctaatcttctctcaataatgcttgccgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29926026 |
atttaactacattttgttaagttagaaatgtgttttc---tcaacttataataaatttatatttataccgtcctaatcttctctcaataatgcttgccgt |
29925930 |
T |
 |
| Q |
201 |
tgagagtgtacgggtattgagat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29925929 |
tgagagtgtacgggtattgagat |
29925907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University