View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_low_116 (Length: 202)
Name: NF7337_low_116
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_low_116 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 39073691 - 39073864
Alignment:
| Q |
17 |
cactttcatcacaatgcattaattctacaactcctagtgctttgttattgtccccttcttccggttgtgacgtctggccttttgcaccaaatttactact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39073691 |
cactttcatcacaatgcattaattctacaactcctagtgctttgttattgtccccttcttccggttgtgacgtttggccttttgcaccaaatttactact |
39073790 |
T |
|
| Q |
117 |
cacttccacaacagctgccacagtggacttacccgccggagttcaatttgacgccggaggacattcacaggttc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39073791 |
cacttccacaacagctgccacagtggacttacccgccggagttcaatttgacgccggaggacattcacatgttc |
39073864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University