View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_low_30 (Length: 483)
Name: NF7337_low_30
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 440; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 19 - 466
Target Start/End: Original strand, 37548881 - 37549328
Alignment:
| Q |
19 |
tgtacacgatagtatggatatagcatcaacaattctttgaacacttgcaacttcttgcccaaactatggcatcatcgagaagaaccatcattgtaaaagg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37548881 |
tgtacacgatagtatggatatagcatcaacaattcttggaacacttgcaacttcttgcccaaactatggcatcatcgagaagaaccatcattgtaaaagg |
37548980 |
T |
 |
| Q |
119 |
cttggtccattgaaggctgtttcagtcttagaaatatatcatcaagggattcagatgaggaaacacgagagatcatatcttgttgtgtttgccgtgtggg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37548981 |
cttggtccattgaaggctgtttcagtcttagaaatatatcatcaagggattcagatgaggaaacatgagagatcatatcttgttgtgtttgccgtgtggg |
37549080 |
T |
 |
| Q |
219 |
taaaaaccctttggccccaccgatgtcggccttgaaactcgtaaaccctttctttaatgtttgccatgttgaacccaaaccataagttccagaagtattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37549081 |
taaaaaccctttggccccaccgatgtcggccttgaaactcgtaaaccctttctttaatgtttgccatgttgaacccaaaccataagttccagaagtattt |
37549180 |
T |
 |
| Q |
319 |
ccataatgagtattgcctttatcaagcaaggaaaccttagcagagtctaagtttctctcttctgccttcaatttagatgcttgtccactctgctgtctga |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37549181 |
ccataatgagtattgcctttatcaagcaaggaaaccttagcagagtctaagtttctctcttctgccttcaatttagatgcttgtccactctgctgtctga |
37549280 |
T |
 |
| Q |
419 |
caccagcatacttcctgctgatcgcttcactgcttgaactgtatcttc |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37549281 |
caccagcatacttcctgctgatcgcttcactgcttgaactgtatcttc |
37549328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University