View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_low_58 (Length: 319)
Name: NF7337_low_58
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 293; Significance: 1e-164; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 11 - 303
Target Start/End: Complemental strand, 7774826 - 7774534
Alignment:
| Q |
11 |
atgaatataattgtgatatggtgttgcatctttcaccatcatatctgaatttatgcattttgctgattttatgtttcattcttacttccaacagatttca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7774826 |
atgaatataattgtgatatggtgttgcatctttcaccatcatatctgaatttatgcattttgctgattttatgtttcattcttacttccaacagatttca |
7774727 |
T |
 |
| Q |
111 |
tcaatgatgcaaagaattagacatagaatcaaaatggttaagctaagactaaaagtaaaattccatcttgatttcttgggagcactgtcgctgcctttgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7774726 |
tcaatgatgcaaagaattagacatagaatcaaaatggttaagctaagactaaaagtaaaattccatcttgatttcttgggagcactgtcgctgcctttgt |
7774627 |
T |
 |
| Q |
211 |
cagactgcgacgaatccatctttctcttgttttctggggatgcaccgattaagtccaaaaatcgacctcttcttgaaccattcatattcttaa |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7774626 |
cagactgcgacgaatccatctttctcttgttttctggggatgcaccgattaagtccaaaaatcgacctcttcttgaaccattcatattcttaa |
7774534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 161 - 304
Target Start/End: Complemental strand, 7779487 - 7779341
Alignment:
| Q |
161 |
aaaagtaaaattccatcttgatttcttgggagcactgtcgctgcctttgtcagactgcgacgaatccatc---tttctctt-gttttctggggatgcacc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||| ||| |||||||| ||||||||| || |||| |
|
|
| T |
7779487 |
aaaagtaaaattccatcttgatttcttgggagcactgttgcggcctttgtcagactgcgatgaatcgatcttttttctcttatttttctgggaat-cacc |
7779389 |
T |
 |
| Q |
257 |
gattaagtccaaaaatcgacctcttcttgaaccattcatattcttaat |
304 |
Q |
| |
|
|||| || ||||||| | |||| ||||||| || |||||||||||| |
|
|
| T |
7779388 |
aattatgttcaaaaatgcatctctccttgaactatgcatattcttaat |
7779341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 97 - 159
Target Start/End: Complemental strand, 7779583 - 7779521
Alignment:
| Q |
97 |
tccaacagatttcatcaatgatgcaaagaattagacatagaatcaaaatggttaagctaagac |
159 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| | | ||||||||||||||||| ||||| |
|
|
| T |
7779583 |
tccaacagatttcataaatgatgcaaagaattagaaacataatcaaaatggttaagcaaagac |
7779521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 57 - 150
Target Start/End: Complemental strand, 7768911 - 7768822
Alignment:
| Q |
57 |
gaatttatgcattttgctgattttatgtttcattcttacttccaacagatttcatcaatgatgcaaagaattagacatagaatcaaaatggtta |
150 |
Q |
| |
|
||||| || ||||||||||||| ||||||||| ||| |||||| | ||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
7768911 |
gaattcatacattttgctgattctatgtttcactcta----ccaacatacttcatcaatgatgtaaggaattagacatagaatcaaaatggtta |
7768822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 233
Target Start/End: Complemental strand, 7768447 - 7768391
Alignment:
| Q |
177 |
cttgatttcttgggagcactgtcgctgcctttgtcagactgcgacgaatccatcttt |
233 |
Q |
| |
|
||||||||| ||| |||||||| ||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
7768447 |
cttgatttcctggaagcactgttgctgcctttgttagactgcgatgaatcaatcttt |
7768391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 299
Target Start/End: Original strand, 12815099 - 12815222
Alignment:
| Q |
179 |
tgatttcttgggagcactgtcgctgcctttgtcagactgcgacgaatccatcttt---ctcttgttttctggggatgcaccgattaagtccaaaaatcga |
275 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||| ||||| ||| | ||||| |||||||||||||| || |||| | ||||||||||||| | |
|
|
| T |
12815099 |
tgatttcttgcgagcactgctgctgtctttgtcagaatgcgatgaaccagtcttttttctcttgttttctggagaatcaccaagtaagtccaaaaatgca |
12815198 |
T |
 |
| Q |
276 |
cctcttcttgaaccattcatattc |
299 |
Q |
| |
|
||||| ||||||||| ||||||| |
|
|
| T |
12815199 |
cctctccttgaaccaggcatattc |
12815222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University