View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_low_84 (Length: 248)
Name: NF7337_low_84
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_low_84 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 14944733 - 14944966
Alignment:
| Q |
13 |
aatatggcaacatcttttccctccgattcggttcacgccttgtaatcgtgagttcatcacaatctgcatttcaagaatgctttaccaaaaacgatgttgt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14944733 |
aatacggcaacatcttttccctccgattcggttcgcgccttgtaatcgtgagttcatcacaatctgcatttcaagaatgctttaccaaaaacgatgttgt |
14944832 |
T |
 |
| Q |
113 |
attagccaatcgaccgtataatatcgctggcaagtacatcttctacaactgtaccaccataggatcatgttcctatggtgatcagtggatcaacctccgt |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14944833 |
attagccaatcgaccgtataatattgctggcaagtacatcttctacaactgtaccaccataggatcatgctcctatggtgatcactggatcaacctccgt |
14944932 |
T |
 |
| Q |
213 |
cgaataagtactcaagatcttctttcgatacaac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14944933 |
cgaataagtactcaagatcttctttcgatacaac |
14944966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University