View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7337_low_88 (Length: 243)
Name: NF7337_low_88
Description: NF7337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7337_low_88 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 67 - 225
Target Start/End: Original strand, 39952048 - 39952206
Alignment:
| Q |
67 |
tctctagtctagtaactgatgagtgactattctattctattggcatttagctcgaggatataggtactgtcaatatcaaacacacgtgtcacaacatcac |
166 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952048 |
tctctattctagtaactgatgaatgactattctattctattggcatttagctcgaggatataggtactgtcaatatcaaacacacgtgtcacaacatcac |
39952147 |
T |
|
| Q |
167 |
aggttgagccctctcaaataaaacaaacacattcaaaaccaaacagaaactgcacttct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952148 |
aggttgagccctctcaaataaaacaaacacattcaaaaccaaacagaaactgcacttct |
39952206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 39951928 - 39952001
Alignment:
| Q |
1 |
aatcaatactaatcccattccacaaaacatgcattttttccctcctttagaatttgaaacctttgttctctagt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39951928 |
aatcaatactaatcccattccacaaaacatgcattttttccctcctttagaatttgaaacctttgttctgtagt |
39952001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University