View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7338_low_4 (Length: 266)
Name: NF7338_low_4
Description: NF7338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7338_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 3160352 - 3160589
Alignment:
| Q |
11 |
gtggtcctgagtattgaatagactttcagagcattacttgaacccttaaataaccctattggccttccttacaccaatcaaggtgcaggtctaacatcgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3160352 |
gtggtcctgagtattgaatagactttcagagcattacttgaacccttaaataaccctattggccttccttacaccaatcaaggtgcaggtctaacatctt |
3160451 |
T |
|
| Q |
111 |
atnnnnnnnnntgtaggtctaaaaggaaaattttgtagcaatgaagttttgaattgatgcaccaagatacttattaaccaaatgaaaacatttttaatga |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3160452 |
ataaaaaaaaatgtaggtctaaaaggaaaattttgtagcaatgaagttttgaattgatgcaccaagatacttattaaccaaatgaaaacatttttaatga |
3160551 |
T |
|
| Q |
211 |
ttaatcaattcactaatcacactacaacactacagctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3160552 |
ttaatcaattcactaatcacactacagcactacagctc |
3160589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University