View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7338_low_5 (Length: 212)
Name: NF7338_low_5
Description: NF7338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7338_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 35259116 - 35259286
Alignment:
| Q |
17 |
atactaagcatgtaaaacatatatttgttctccagacaagttgataaggattgtgagcttctagaacaagagggaattatggactatagtctgctacttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35259116 |
atactaagcatgtaaaacatatatttgttctccagacaagttgataaggattgtgagcttctagaacaagagggaattatggactatagtctgctacttg |
35259215 |
T |
 |
| Q |
117 |
gcattcatttcaaaagtatatcacaagatggggatgttcttccgatagcacctcaatctcctaccggtaac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35259216 |
gcattcatttcaaaagtatatcacaagatggggatgttcttccgatagcacctcaatctcctaccggtaac |
35259286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 68 - 130
Target Start/End: Complemental strand, 19641010 - 19640948
Alignment:
| Q |
68 |
tgtgagcttctagaacaagagggaattatggactatagtctgctacttggcattcatttcaaa |
130 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19641010 |
tgtgagcttctggaacaggagggaattatggactatagtctactagttggcattcatttcaaa |
19640948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University