View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7339_high_7 (Length: 365)
Name: NF7339_high_7
Description: NF7339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7339_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 352
Target Start/End: Complemental strand, 52923384 - 52923033
Alignment:
| Q |
19 |
acaaaatccccatgattactactaacaatgaatgaagaaatacccgcttctacatgaaatgtcacgtccatagccacccctctttaggcttctctcattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52923384 |
acaaaatccccatgattactactaacaatgattgaagaaatacccgcttctacatgaaatgtcacgtccatagccacccctcattaggcttctctcattt |
52923285 |
T |
|
| Q |
119 |
caactcattttgttgttagaccgtcccattctgatgttattgcaac------------------tgtttccaaatattagaagcttgcaacccaacatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52923284 |
caactcattttgttgttagaccgtcccattctgatgttattgcaaccgattcaatgtgtaccactgtttccaaagattagaagcttgcaacccaacatta |
52923185 |
T |
|
| Q |
201 |
ttttcaatggaaaaattgttgttgacggggtttgtaattttctccttgtaaaaattgcaattattgttgagagggtttgcaattttgtctatgcaaaaac |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52923184 |
ttttcaatggaaaaattgtagttgacggggtttgtaattttctccttgtaaaaattgcaattattgttgagagggtttgcaattttgtctatgcaaaaac |
52923085 |
T |
|
| Q |
301 |
tgtatgaagattataagttgagtaatacatttttcgttgagaggtcgtgtgt |
352 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||| |||||||| |
|
|
| T |
52923084 |
tgtatgaagattataagttgagtaatatattttttgttgagagatcgtgtgt |
52923033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University