View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7339_high_9 (Length: 229)
Name: NF7339_high_9
Description: NF7339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7339_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 52922975 - 52922755
Alignment:
| Q |
3 |
tgtgtgctttcacttgtggagagatttcttcttattattttatattcaaatgttagttgtcagtaaatcgttagaggagagataaatcttagtttttggg |
102 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| | || |
|
|
| T |
52922975 |
tgtgtgttttcccttgtggagagatttcttcttattattttatattcaaatgttagttgtcagtaaatcgttagatgagagataaatcttggtttctagg |
52922876 |
T |
 |
| Q |
103 |
atcgaaccaatgacctccttcttaaatctcattcaatatcccttaggttatcaatcgnnnnnnnttatagagcaaatgggttctccaacattagctttac |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||| | |
|
|
| T |
52922875 |
atcgaaccgatgacctccttcttaaatctcattcaatattccttaggttatcaatcgaaaaaaattatagagcaaatgggttctccaacactagctttgc |
52922776 |
T |
 |
| Q |
203 |
cccttcataatttcatctcac |
223 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
52922775 |
cccttcataatttcaactcac |
52922755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University