View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_high_12 (Length: 288)
Name: NF7341_high_12
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 34862530 - 34862272
Alignment:
| Q |
19 |
agggaggacttgaggaaatggtttctctctatggaatgtgcactttttcgctaccgttttcgttttctaactactgaagctcaggtaaaatctgtcctta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862530 |
agggaggacttgaggaaatggtttctctctatggaatgtgcactttttcgctaccgttttcgttttctaactactgaagctcaggtaaaatctgtcctta |
34862431 |
T |
 |
| Q |
119 |
accacatgtattttgcatttcaagtaagatgctaattatcgcatgtttttcttgtgagttcacagagggcgatcatggacgaatttgaccttacttgcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862430 |
accacatgtattttgcatttcaagtaagatgctaattatcgcatgtttttcctgtgagtgcacagagggcgatcatggacgaatttgaccttacttgcaa |
34862331 |
T |
 |
| Q |
219 |
ggctgttaacaatgtggaatttgaggtaatgacatgccatttgttttattggttttcat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34862330 |
ggctgttaacaatgtggaatttgaggtaatgacatgccatttgttttataggttttcat |
34862272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University