View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_high_16 (Length: 256)
Name: NF7341_high_16
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_high_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 256
Target Start/End: Original strand, 11073268 - 11073503
Alignment:
| Q |
21 |
tgggaacttcaataattgttttgttgtgacctagatcgcagttacatacccttataaaaaaccctaggcatgttttttgtttcttcacaattacacgtac |
120 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11073268 |
tgggaacttcaataattgttttgttgcgacctagatcgcagttacatacccttataaaaaaccctaggcatgttttttgtttcttcacaattacacgcac |
11073367 |
T |
|
| Q |
121 |
attaggactttttggttagatgaaaggatgaaactggatattagatcaaatccaatttcactttatttctgagttggtcatgctcctttttcttttcttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11073368 |
attaggactttttggttagatgaaaggatgaaactggatattagatcaaatccaatttcactttatttctgagttggtcatgctcctttttcttttcttc |
11073467 |
T |
|
| Q |
221 |
tggttatggaattgttaagttatactattgggtttc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11073468 |
tggttatggaattgttaagttatactattgggtttc |
11073503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University