View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_high_17 (Length: 252)
Name: NF7341_high_17
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 48366812 - 48367034
Alignment:
| Q |
13 |
aatatataccatggaatgatgaattgtttgaaactacgatgcagatatatcggacctcttttgcctataggaacaggtcttcatcttcacttctttttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48366812 |
aatatataccatggaatgatgaattgtttgaaactacgatgcagatatatcggacctcttttgcctataggaacaggtcttcatcttcacttctttttct |
48366911 |
T |
 |
| Q |
113 |
tctttatttctgatatttgttgtttgaatagctattttgttttgagacaaaatttatgtgcagctcccttgtataccatttttattggtctttagtcaca |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48366912 |
tctttatttctgatatttgttggttgaatagctattttgttttgagacaaaatttatgtgcagctcccttgtataccatttttattggtctttagtcaca |
48367011 |
T |
 |
| Q |
213 |
atttgacacgactaagtgaaaaa |
235 |
Q |
| |
|
||||||||||| || |||||||| |
|
|
| T |
48367012 |
atttgacacgattatgtgaaaaa |
48367034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 10273937 - 10273867
Alignment:
| Q |
17 |
tataccatggaatgatgaattgtttgaaactacgatgcagatatatcggacctcttttgcctataggaaca |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
10273937 |
tataccatggaatgatgaattgtttgaaaccacagtgcagatatatcaaacctcttttgcctttaggaaca |
10273867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 10244211 - 10244138
Alignment:
| Q |
17 |
tataccatggaatgatgaattgtttgaaactacgatgcagatatatcggacctcttttgcctataggaacaggt |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || |||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
10244211 |
tataccatggaatgatgaattgtttgaaaccacagtgaagatttatcaaacctcttttgcctttaggaacaggt |
10244138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 10266192 - 10266130
Alignment:
| Q |
13 |
aatatataccatggaatgatgaattgtttgaaactacgatgcagatatatcggacctcttttg |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || || |||| |||| |||||||||| |
|
|
| T |
10266192 |
aatatataccatggaatgatgaattgtttgaaaccacagtgaagatttatcaaacctcttttg |
10266130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 13980235 - 13980172
Alignment:
| Q |
13 |
aatatataccatggaatgatgaattgtttgaaactacgatgcagatatatcggacctcttttgc |
76 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||| ||| | ||| |||||| |
|
|
| T |
13980235 |
aatatataccatggaatgatgaagtgtttgaaacaacagtgcagatacatcaggccttttttgc |
13980172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University